Симбиотические энтерококки и проблемы энтерококковой оппортунистической инфекции

Комментарии

В.М. Бондаренко, А.Н. Суворов

Рецензенты:
А.Ф. Мороз, доктор биологических наук, профессор, Заслуженный деятель науки РФ
В.Г. Лиходед, академик Российской академии медико-технических наук, доктор медицинских наук, профессор

Введение

Энтерококки, входящие в состав нормальной микрофлоры пищеварительного тракта человека, играют важную роль в обеспечении колонизационной резистентности слизистых. В то же время они являются представителями группы условно-патогенных бактерий, способных вызывать аутоинфекцию, а при накоплении в окружающей среде – приводить к экзогенному инфицированию. В последние годы изучение энтерококков как биологических объектов и оценка их роли в физиологии и патологии человека чаще всего рассматриваются сквозь призму участия энтерококков в возникновении инфекционных заболеваний, количество которых постоянно нарастает. Однако односторонняя оценка микроорганизмов зачастую не позволяет объективно оценить их значение, так как многие из них являются составной частью нормальной микрофлоры и обязательными компонентами привычных пищевых продуктов. Обнаружение у больного энтерококков часто ставит неразрешимые вопросы перед клиницистами в плане определения врачебной тактики. Возник вопрос о безопасности применения в медицинской практике препаратов-пробиотиков, содержащих жизнеспособные симбиотические энтерококки. В данной книге мы постарались рассмотреть проблему энтерококков с разных точек зрения и объяснить причины, определяющие их способность вызывать развитие инфекционного процесса, т.е. возможность проявления патогенных свойств энтерококками различных штаммов одного и того же вида.

Общая характеристика бактерий рода Enterococcus

Энтерококки, ранее относимые к стрептококкам группы D, — многочисленная группа бактерий рода Enterococcus, включающая виды Е. faecalis, Е. faecium, Е. avium, Е. casseliflavus, Е. durans, Е. gallinarum, Е. raffinosus, Е. irae, Е. malodoratus и Е. mundtii. В клиническом материале от человека встречаются Е. faecalis, Е. faecium, Е. gilvus и E. pallens. Энтерококки содержат групповой антиген, который реагирует с антисывороткой стрептококков серогруппы D по Лэнсфилду. Энтерококки других видов, как правило, не обнаруживаются в клиническом материале от людей.

У новорожденных энтерококки выявляются уже с первых дней жизни, и в последующем на первом году, у детей, находящихся на грудном вскармливании, их уровень колеблется от 106 до 107 КОЕ/г. У детей с искусственным вскармливанием их уровень может достигать 108–109 КОЕ/г. Популяционный уровень энтерококков в кишечнике здорового человека остается стабильным, достигая 107–108 КОЕ/г фекалий. Энтерококкам отводится существенная роль в стимуляции местного гуморального и клеточного иммунитета, что способствует поддержанию колонизационной резистентности [4]. Количество в кишечнике энтерококков в норме не должно превышать общее количество кишечных палочек. Различные виды энтерококков, обнаруженные у теплокровных, указанные в атласе Koneman E.W. и др. [50], представлены в таблице 1.

Таблица 1. Основные представители рода Enterococcus, выделяемые от человека, животных и птиц [50]

ВидХарактеристика
E. faecalisНаиболее частый изолят клинических проб из кишечника человека, обнаруживается также в кишечнике домашней птицы, крупного рогатого скота, свиней, собак, лошадей, овец и коз
E. faeciumВыявляется в клинических пробах от людей; более резистентен к антимикробным средствам, чем Е. faecalis; также выявляется в кишечнике разных видов животных
E. aviumВыделяют из кишечника птиц, собак, человека, штаммы могут иметь групповые D- и G-антигены по Лэнсфилду, образуют H2S
E. duransРедкий клинический изолят: обнаруживают главным образом в молоке и других молочных продуктах
E. casseliflavusВыявляют в растениях, почве и редко – в фекалиях цыплят; первоначально классифицировали как подвид Е. faecium; продуцирует желтый пигмент, подвижен; может выделяться при инфекциях у человека
E. gallinarumИзолируют из фекалий цыплят; один из двух подвижных видов Enterococcus; также был изолирован при инфекциях людей, подвергавшихся гемодиализу
E. raffinosusПервоначально рассматривался как Е. avium (вместе с Е. solitarius и Е. pseudoavium); назван за свою способность продуцировать кислоту из раффинозы; выделяют при инфекциях человека, включая культуры из крови, мочи и абсцессов
E. disparПервоначально считали биохимическим вариантом Е. hirae, но анализ сиквенса 16S РНК показал, что он является новым видом; обнаруживают в пробах от человека (в фекалиях, синовиальной жидкости)
E. flavescensНовый, образующий желтый пигмент подвижный вид; изолирован из проб от человека (крови, абсцессов и гнойного отделяемого больных остеомиелитом)

Морфологические и физиологические свойства. В мазках, приготовленных из бульонной культуры, энтерококки — грамположительные кокки, единичные, парные, в виде небольших скоплений или цепочек. При выращивании на плотной питательной среде в большей степени выражен полиморфизм, проявляющийся как в форме клеток (круглые или вытянутые, иногда в виде коккобактерий), так и в размерах (карликовые и гигантские формы, различные размеры клеток в одной паре или цепочке). Спор и капсул не образуют. Встречаются подвижные варианты, несущие от одного до четырех жгутиков. Энтерококки являются факультативными анаэробами, оптимальная температура культивирования которых составляет 35–37°С. Энтерококки осуществляют метаболизм бродильного типа, ферментируют разнообразные углеводы с образованием в основном молочной кислоты, но не газа, снижая рН до 4,2–4,6. В некоторых случаях восстанавливают нитрат, обычно лактозопозитивные.

Бактерии большинства штаммов энтерококков растут в бульоне, содержащем 6,5% раствор NaCl, при температурах от 10 до 45°С. Каталазоотрицательные, гидролизуют эскулин в присутствии 40% раствора желчи. Некоторые виды энтерококков гидролизуют пирролидонил-β-нафтиламид, за исключением Е. сесоrит, Е. columbae и Е. saccharolyticus. Все штаммы продуцируют фермент лейцинаминопептидазу. Энтерококки хорошо растут на триптиказо-соевом агаре или на агаре, приготовленном на сердечно-мозговом настое, с добавлением к ним 5% крови барана. Некоторые штаммы Е. faecalis проявляют β-гемолитические свойства на агаре, содержащем кровь кролика, лошади или человека, но оказываются негемолитическими на агаровой среде с кровью барана. Часть культур Е. durans являются β-гемолитическими независимо от типа используемой крови.

Для выделения и выращивания энтерококков существует ряд селективных сред: основа кровяного агара с азидом, азидодекстрозный бульон, KF-стрептококковый агар, М-агар для энтерококков, стрептококковый селективный агар и др. На кровяном агаре колонии энтерококков мелкие, кремовые или белые, гладкие с ровным краем, различающиеся по типу гемолиза. Почти все штаммы – гомоферментативные, газа не образуют, конечный продукт ферментации глюкозы и некоторых других углеводов — молочная кислота. Отдельные виды энтерококков разжижают желатин. У энтерококков резко выражены редуцирующие свойства: они обесцвечивают лакмус и метиленовый синий в молоке, редуцируют нитраты в нитриты.

Устойчивость к факторам внешней среды. Энтерококки высокорезистентны к различным факторам внешней среды и дезинфицирующим средствам, могут длительное время сохранять жизнеспособность на предметах домашнего обихода, в течение нескольких месяцев — на обычных агаровых косяках, выдерживают нагревание до 60°С в течение 30 минут.

Энтерококки как причина оппортунистической инфекции

Хорошо известно, что увеличение числа лиц с иммунодефицитными состояниями ведет к нарастанию случаев инфекционных процессов, вызываемых условно-патогенными микроорганизмами, в том числе и энтерококками [5]. В последние десятилетия возросла роль двух видов энтерококков – E. faecalis и E. faeсium – как нозокомиальных патогенов в различных клиниках [26, 33, 62, 73]. Принимая во внимание увеличение числа лиц с иммунодефицитными состояниями, нельзя исключить возможное увеличение спектра видов энтерококков, причастных к патологии у человека.

Недавно была проведена оценка значения энтерококков как возбудителей послеоперационных инфекционных осложнений после операций аортокоронарного шунтирования, реконструктивных операций на сердце и трансплантации почек. Энтерококки изолировали из крови, операционного материала (клапанов сердца), мочи, отделяемого трахеи, ран, плевральной жидкости, внутрисосудистых катетеров. Было изолировано 465 штаммов энтерококков, которые встречались при воспалительных процессах у пациентов отделений трансплантации почек – в 39,8% случаев, затем по показателю высеваемости следовали пациенты реанимационного отделения – 34,6%, сердечно-сосудистой хирургии – 20,4% и материал из операционного блока – 4,2%. Наибольший пул этих микробов изолирован из мочи – в 47,7% и из трахеи – в 24,3%. Энтерококковые бактериемии регистрировались в 9,7%, имея значительный удельный вес среди грампозитивной микрофлоры – 38,5% всех изолятов. Из крови пациентов различных отделений выделено 45 штаммов (E. faecalis – 0,7%, E. faecium – 14,6%).Отмечена высокая степень резистентности энтерококков к антибиотикам [6].

По данным Murray B.E., в 1990 году 80–90% выделенных у человека энтерококков приходилось на долю E. faecalis и 5–10% – на E. faecium [59]. Энтерококки, изолированные при бактериемиях, составили 38,5% от грампозитивной микрофлоры и 9,7% – от всех изолятов энтерококков. По этиологической значимости энтерококки заняли второе место после коагулазоотрицательных стафилококков. Свыше 60% тяжелых энтерококковых инфекций зарегистрированы в отделениях интенсивной терапии [73]. Энтерококки изолированы из крови преимущественно пациентов реанимационного отделения. Другие авторы также указывают на значительную частоту энтерококковых бактериемий: 7–10%, 15,3% [8, 9]. Наряду с другими микробами энтерококки являются возбудителями инфекционных поражений клапанов сердца [28].

Значительное число штаммов энтерококков (n = 113) выделено из отделяемого трахеи пациентов с искусственной вентиляцией легких (ИВЛ), что составило 24,3% от всего пула энтерококков. Эти микроорганизмы выделены только в 1,7% случаев инфекций дыхательных путей [9]. Раневая инфекция, вызванная энтерококками, составила 3%. Наибольший пул энтерококков изолирован из мочи – 222 штамма, что составило 47,7%. Одним из основных возбудителей инфекций мочевыводящих путей является E. faecalis, занимающий второе место после кишечной палочки [1]. Особенно опасны инфекции мочевыводящих путей, вызванные энтерококками, для больных с пересаженной почкой. У E. faecalis описан цитотоксин, вызывающий лизис эритроцитов, нейтрофилов. Штаммы, продуцирующие цитотоксин, проявляют высокую резистентность к химиотерапевтическим препаратам [27]. Обнаружено также, что E. faecalis обладает высокой протеолитической активностью в отношении ряда белков – гидролизирует желатин, казеин, коллаген, гемоглобин и другие белки. Бактерии способны длительно персистировать в мочеполовой системе [1]. Наиболее распространенные заболевания, вызванные энтерококками, представлены в таблице 2.

Таблица 2. Заболевания человека, вызываемые энтерококками

Название заболевания энтерококковой этиологии
Эндокардит
Инфекции кожи и мягких тканей
Инфекции мочеполовой системы
Остеомиелит
Септический артрит
Бактериемии
Инфекции дыхательных путей
Интраабдоминальные инфекции
Эндофтальмит

Энтерококки были названы внутрибольничным патогеном 90-х годов минувшего века [59]. Усиление их роли как нозокомиального патогена в значительной степени обуславливается множественной резистентностью к антибиотикам. Описана устойчивость энтерококков к беталактамным антибиотикам, низким дозам аминогликозидов. В последние годы стала расти их устойчивость к ванкомицину [8, 9, 22, 33, 44]. Факторами риска для распространения ванкомицинустойчивых штаммов являются использование ванкомицина для профилактики, частое применение его для терапии инфекционных осложнений, использование цефалоспоринов III поколения, длительные сроки госпитализации и тяжелое течение заболевания [33].

Роль энтерококков как экзогенного источника инфекции определяется тем, что они длительно сохраняют жизнеспособность на объектах внешней среды, даже в присутствии антисептических растворов. Одной из основных причин распространения энтерококков в стационарах является присущая им природная резистентность к некоторым часто применяемым антибиотикам, в частности к аминогликозидам и цефалоспоринам III поколения, вследствие их селективного давления при назначении больным [8, 9, 22, 33, 73]. Широко распространена резистентность к хлорамфениколу, эритромицину, тетрациклину и клиндамицину. Чувствительные к ванкомицину до 80-х годов прошлого столетия энтерококки к настоящему времени все чаще замещаются ванкомицинрезистентными штаммами. За последние 20 лет заболеваемость, вызванная данными штаммами энтерококков в детских стационарах, возросла более чем в 20 раз [8]. Энтерококки были высокоустойчивы к цефалоспоринам I и II поколений, фторхинолонам, амногликозидам, а также к оксолиновой кислоте. Среди клинических изолятов 70% и более штаммов E. faecalis были чувствительны к ванкомицину, амоксициллину/клавулановой кислоте, имипенему, нитрофурантоину; 51–70% штаммов E. faecium были чувствительны к ванкомицину, нитрофурантоину и нитроксолину [8].

Интенсивные исследования последних лет позволили установить, что данные бактерии синтезируют существенное количество веществ, так называемых факторов вирулентности, способствующих развитию инфекционного процесса. К таким факторам можно отнести поверхностные белки, участвующие в процессе адгезии и инвазии, экскретируемые белки и токсины, обеспечивающие повреждение тканей хозяина, белки, обуславливающие устойчивость к антибиотикам, а также факторы, индуцирующие воспаление (табл. 3).

При этом нельзя не отметить, что многие из так называемых факторов патогенности энтерококков являются необходимыми компонентами их функционирования, обеспечивающими их существование в свойственной им экосистеме, и не связаны напрямую с повреждением тканей хозяина или подавлением системы иммунитета. Так, адгезины жизненно необходимы для нормальной колонизации в желудочно-кишечном тракте, а гидролаза желчных кислот повышает их шансы выжить в двенадцатиперстной кишке. Детальный молекулярно-генетический анализ вирулентных штаммов энтерококков показал, что большинство генов вирулентности локализовано достаточно компактно на геноме данных штаммов. В настоящее время достаточно хорошо установлено, что участки генома с генами вирулентности являются мобильными элементами и могут передаваться от одного штамма другому. Данные генетические элементы, называемые «островами» патогенности, могут содержать различный набор генов вирулентности, включая гены устойчивости к антибиотикам [3, 58]. Большинство исследователей полагает, что именно данные гены наиболее важны для развития энтерококкового инфекционного процесса [70]. На «островах» патогенности обнаруживают комплекс генов цитолизинов cyl, ген адгезина esp, ген поверхностно экспрессируемой сериновой протеиназы spr, гидролазы желчных bhs, гены устойчивости к ванкомицину и ряд других. Однако достоверной связи между каким-либо из факторов в геноме и развитием инфекции показать до сих пор не удалось.

Таблица 3. Факторы патогенности энтерококков

ФункцияФакторГен(ы)Литература
Адгезия и колонизация Капсула
Адгезин Еsp
Адгезин Asa
Фактор агрегации
Адгезин EfaA
Рецептор коллагена
cps
asa1, 373
esp
agg
efaA
ase
Bentley et al., 2006
Hancock et al., 2002
Nallapareddy et al., 2000
Bensing, Dunny, 1993
Creti et al., 2004
Пенетрация, колонизация, повреждение тканей Желатиназа
Сериновая
протеиназа
Fsr-регулятор
Гиалуронидаза
Цитолизин
gelE
spr
fsr
сyl
Qin et al., 2000
Tacao et al., 1997
Gilmore, 1990
Nakayama et al., 2006
Danny et al., 1978
Устойчивость к антибиотикам и микробицидным факторам организма и ингибиция других бактерий Устойчивость к антибиотикам.
Фактор устойчивости к желчным кислотам
tetM, vanA, B, C
eryA, B
bsh
glsB
Roberts et al., 2005
Evers et al., 1993
Manson et al., 2003
Oh et al., 1998
Begley et al., 2005
Dashkevicz et al., 1989
Nannini et al., 2005
Giard et al., 2002
Гемолиз, токсигенность, бактериоциногенность Гемолизины
Цитолизины
и бактериоцины
Феромоны
hly
cylA, B, M
cpd, cob, ссf
Ike, Clewell, 199 2
Gilmore et al., 1994
Nakayama et al., 2006
Dunny et al., 1979

Есть ли польза от энтерококков?

Все сказанное выше указывает на существенную роль энтерококков в развитии инфекционных процессов и может определять отношение клиницистов к данным бактериям. Самым простым решением было бы элиминировать энтерококки из нашей экосистемы. Однако простые решения не всегда возможны. Дело в том, что энтерококки различных видов являются естественными обитателями нашего организма, они одними из первых колонизируют организм новорожденных, а система врожденного иммунитета не распознает их как врагов. Более того, практически все птицы и млекопитающие в норме колонизированы энтерококками (табл. 4). В соответствии с существующими стандартами в норме в толстом кишечнике должно обитать от 107 до 108 жизнеспособных клеток энтерококков на грамм [10]. Наиболее частыми представителями энтерококков, колонизирующих человеческий организм, являются энтерококки двух видов – E. faecium и E. faecalis. Благодаря уникальной даже для бактерий жизнеспособности (устойчивость к низким значениям рН, к желчным кислотам, к широкому диапазону температур) энтерококки обитают практически во всех отделах кишечника, часто обнаруживаются во влагалище и желудке [50]. Энтерококки как естественные обитатели кишечника принимают самое активное участие в происходящих там метаболических процессах, синтезе витаминов, гидролизе сахаров, в частности лактозы, деконъюгировании желчных кислот, элиминации патогенных бактерий. Количественное содержание энтерококков в кишечнике находится в строгом соответствии с уровнем содержания других индигенных бактерий, в частности кишечных палочек, лактобацилл и бифидобактерий [4]. Энтерококки являются эффективными иммуностимуляторами, способными поддерживать адекватный для нормальной работы системы врожденного иммунитета уровень цитокинов широкого спектра.

Таблица 4. Частота обнаружения энтерококков у млекопитающих и птиц [49]

Вид энтерококковЧеловекКрупный
рогатый
скот
СвиньяПтица
E. faecalis++(+)+++
E. faecium+++++++
E. durans/hirae(+)(+)(+)
E. gallinarum(+)(+)
E. casseliflavus(+)+
E. cecorum/columbae++

Будучи столь широко распространенными в природе и обладая важной способностью гидролизовать ряд сахаров, включая лактозу (энтерококки, как лактококки, лактобациллы и целый ряд других бактерий, относятся к молочнокислым микроорганизмам), энтерококки широко и с давних пор используются в производстве пищевых продуктов. Так, энтерококки необходимы в сыроварении (табл. 5), применяются для приготовления целого ряда мясных продуктов, ферментированных продуктов на основе сои и зерновых. Основной причиной, объясняющей столь широкое применение энтерококков в пищевой промышленности, помимо их высокой устойчивости к воздействию кислот, солей и высокой температуры является их способность эффективно подавлять болезнетворные бактерии в самих пищевых продуктах. Незначительное содержание энтерококков в колбасах, сырах и мясном фарше не позволяет размножаться в пищевых продуктах таким микроорганизмам, как стафилококки, листерии и кишечные палочки. Основная причина антагонистической активности энтерококков – их способность продуцировать короткие пептиды – энтероцины. Данные пептиды, которые чаще всего относятся к педиоциноподобным бактериоцинам второго класса [48], способны при контакте с бактерией вызывать повреждение клеточной стенки с последующей гибелью клетки. По-видимому, механизм повреждающего действия энтероцинов сходен с таковым, детально изученным у таких лантибиотиков, как низин и мерзацидин [74]. В настоящее время подробно изучены структура и механизм действия лактицина, синтезируемого, как и лантибиотик низин, бактериальными клетками Lactococcus lactis. Недавно обнаруженный у лактококков новый лактицин 3147 состоит из двух пептидов – LtnA1 и LtnA2, синергическое действие которых обуславливает антибиотическую активность в наномолярной концентрации. Полагают трехступенчатую модель механизма повреждающего действия лактоцина 3147:

  1. пептид LtnA1 взаимодействует с липидом II мембраны клетки-мишени,
  2. затем иммобилизованный на липиде II компонент лактоцина LtnA1 взаимодействует с компонентом LtnA2, образуя двукомпонентный комплекс,
  3. далее С-терминальный конец двукомпонентного комплекса транслоцирует в мембрану с формированием поры, через которую из пораженной клетки выходит наружу содержимое ее цитоплазмы [74].

Следует отметить, что энтероцины широко распространены среди штаммов энтерококков, список которых приведен в таблице 6.

Таблица 5. Штаммы энтерококков, применяемые в пищевой промышленности [36]

Штамм энтерококковВид пищевого продуктаСсылка
E. faecalis B114Сыр «камамбер»Sulzer, Busse, 1991
E. faecium 7C5Сыр TaleggioGiraffa et al., 1995
E. faecalis INIA 4Сыр ManchegoJoosten et al., 1995
E. faecalis INIA 4Сыр HispanoGarde et al., 199 7
E. faecalis INIA 4Сыр ManchegoNunez et al., 1997
E. faecalis INIA 4Сыр HispanoOumer et al., 2001
E. faecium CCM 4231Сыр Saint-PaulinLaukova et al., 2001
E. faecium CCM 4231Испанская колбаса холодного копченияCallewaert et al., 2000
E. faecium RZS C13Испанская колбаса холодного копченияCallewaert et al., 2000
E. faecium CTC49 2Колбаса твердого копченияAymerich et al., 2000
E. faecium CTC49 2Копченая свининаAymerich et al., 2002
E. faecalis TAB 28ТворогRodriguez et al., 2001
E. faecium RZS C5Сыр CheddarFoulquie Moreno et al., 2003
E. faecium DPC 1146Сыр CheddarFoulquie Moreno et al., 2003
E. faecium FAIR-E 198Сыр «фета»Sarantinopoulos et al., 2002
E. casseliflavus IM 416K1Итальянская колбаса (Cacciatore)Sabia et al., 2003

Таблица 6. Некоторые энтероцины, выделенные из энтерококков

ЭнтероцинПрименениеСсылка
Enterocin 226 NWCСыр MozzarellaVillani et al., 1993
Enterocin 4Молочная промышленностьRodriguez et al., 1997
Enterocin CCM 4231Корм для скотаLaukova et al., 1998
Enterocin CCM 4231Соевое молокоLaukova, Czikkova, 199
Enterocin CCM 4231Сосиски Hornad salamiLaukova et al., 199
Enterocin CCM 4231БрынзаLaukova, Czikkova, 2001
Enterocin CRL 35Козий сырFarias et al., 199
Enterocin CRL 35Мясные продуктыVignolo et al., 2000
Enterocin CTC 49 2Мясные продуктыAymerich et al., 2000
Enterocin CTC 49 2Свинина копченаяAymerich et al., 2002
Энтероцины А и ВЗакваска «Авена»Суворов и др., 2003

Энтерококки в составе препаратов и продуктов – пробиотиков

Полезные для человека свойства энтерококков (высокая антагонистическая активность в отношении патогенной микрофлоры, участие в формировании и поддержании иммунитета, участие в нормальном пищеварении, противовоспалительные свойства, витаминообразование) определили их частое использование в медицине в качестве пробиотиков. Под пробиотиками в настоящее время понимают препараты или пищевые продукты, содержащие живые бактерии, которые после попадания в человеческий организм оказывают благотворное воздействие, в первую очередь за счет восстановления нормального микробиоценоза кишечника [4, 7, 29, 37].

Таким образом, пробиотики, содержащие жизнеспособные энтерококки, могут входить в состав пищевых продуктов или фармакологических препаратов. Бактерии, входящие в состав пробиотиков, должны быть способными сохранять жизнеспособность при прохождении желудочно-кишечного тракта, должны подавлять развитие патогенных бактерий, положительно влиять на собственную микрофлору человеческого организма и быть безопасными для человека [68]. Наиболее часто в качестве пробиотиков используют молочнокислые бактерии Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus plantarum, Enterococcus faecium, Enterococcus faecalis, Streptococcus thermophilus, Lactococcus lactis, Leuconostoc mesenteroides, Propionibacterium freudenreichii, Pediococcus acidilactici, Sporolactobacillus inulinus, Escherichia coli, Saccharomyces cerevisiae или Saccharomyces boulardii 37, 42]. Благодаря широкому распространению в природе энтерококки на основе штаммов E. faecium и E. faecalis применяют не только для человека, но и для животных. Так, в 2004 году девять различных штаммов E. faecium были утверждены European Commission (EC) для применения на животных.

Одним из наиболее хорошо исследованных штаммов является E. faecium SF68, который входит в состав ряда фармакологических препаратов. Данный штамм проявил эффективность в клинических исследованиях при лечении диареи, вызванной приемом антибиотиков [74], а также диареи у детей [19]. E. faecium SF68 в клинических исследованиях, проведенных в Бельгии, продемонстрировал эффективность при острой диарее у взрослых [24]. Прием данного пробиотика позволял сокращать продолжительность острой диареи на один – три дня. E. faecium SF68 эффективен и при лечении животных. Так, включение данного штамма в состав корма для собак существенно улучшало как гуморальный, так и клеточный иммунитет [21]. Кисломолочный продукт, содержащий E. faecium SF68 (GAIO, MD Foods, Aarhus, Denmark), в течение длительного времени продается в Дании, причем его исследования показали гипохолестеринемический эффект [13]. В аналогичных исследованиях, проведенных в России с пробиотиком, содержащим штамм E. faecium L3, на больных с хроническими гепатитами, было также показано существенное улучшение целого ряда биохимических параметров, включая уровень холестерина крови и билирубина [12]. Пробиотический продукт, приготовленный на основе соевого молока, содержащий штамм E. faecium CRL 183 в сочетании с Lactobacillus jugurti, также существенно снижал уровень холестерина. Использование другого штамма – E. faecium PR88 (E. faecium Fargo 688® from Quest International, Naarden, Netherlands) продемонстрировало положительное влияние энтерококков у больных с синдромом раздраженной толстой кишки [14]. Данный штамм был добавлен в состав закваски для приготовления пробиотического сыра «чэддер».

Длительный прием (56 недель) пробиотика на основе штамма E. faecium М-74 добровольцами пожилого возраста с патологиями сердца существенно улучшал показатели функционирования сердечно-сосудистой системы, а также иммунологические параметры, характеризующие степень развития атеросклероза [43]. Накоплен существенный опыт длительного клинического применения пробиотика Линекс® (фирма Lek, Словения). Одна капсула Линекс содержит живые лиофилизированные бактерии: не менее 1,2×107 Bifidobacterium infantis var. liberorum, Lactobacillus acidophilus и Enterococcus faecium. Входящие в состав пробиотика энтерококки, бифидобактерии и лактобациллы поддерживают и регулируют физиологическое равновесие кишечной микрофлоры и обеспечивают ее физиологические функции (антимикробную, витаминообразующую, пищеварительную) во всех отделах кишечника. Показания: лечение дисбактериозов различной этиологии. Линекс может быть назначен одновременно с антибиотиками и химиотерапевтическими препаратами. Дозы и применение: грудные дети и дети до 2-х лет – по 1 капсуле три раза в день; дети от 2-х до 12 лет – по 1 или 2 капсулы три раза в день; взрослые – по 2 капсулы три раза в день. Длительность лечения зависит от причины развития дисбактериоза и индивидуальных особенностей [2]. Обычный курс применения Линекса – 2–4 недели.

Позитивный эффект пробиотика Симбиофлор (Германия), содержащего энтерококки, подтвержден на огромном клиническом материале (более 2000 пациентов). Препарат был эффективным при таких заболеваниях, как хронический тонзиллит, хронический синусит, хронический бронхит, синдром раздраженного кишечника, острый энтерит (Руш К., Руш Ф. Микробиологическая терапия. – М.: Арнебия, 2003).

Штамм E. faecium Walthers ECOFLOR (Walthers Health Care, Den Haag, Netherlands) проявлял эффективность при диарее, активно подавлял листерии за счет продукции энтероцинов и снижал уровень холестерина крови у пациентов. Исследования данного штамма показали также его противоопухолевый эффект. Интересно, что российский штамм E. faecium L3 также оказался мощным продуцентом энтероцинов А и В, подавляющих как грамположительные, так и грамотрицательные патогенные бактерии [76]. Высокая антагонистическая активность данных энтероцинов позволила существенно ускорить эрадикацию патогенных штаммов H. pylori из желудка и двенадцатиперстной кишки [72]. Благотворный эффект приема данного штамма в составе пробиотиков был также продемонстрирован при лечении онкологических больных [11].

Естественным вопросом, беспокоящим клиницистов, которые назначают пробиотики на основе энтерококков, является опасение, что пробиотический энтерококк после приема будет колонизировать желудочно-кишечный тракт интенсивнее, чем естественные обитатели, и в какой-то момент приобретет устойчивость к антибиотикам (в первую очередь – к ванкомицину) либо набор генов вирулентности. Данное опасение, имеющее под собой логическое основание, при ближайшем рассмотрении представляется фантастическим по целому ряду причин.

Во-первых, молочнокислые энтерококки, входящие в состав пробиотиков, не адаптированы к длительной персистенции в человеческом организме, являясь в своей основе производственными штаммами, исходно селекционированными для создания пищевых продуктов. Так, пробиотический штамм L3 в условиях эксперимента уже через две недели после окончания приема полностью элиминируется из организма [75]. Данное наблюдение указывает на низкую вероятность колонизации пробиотиками такого рода даже в случае передачи им генов лекарственной устойчивости.

Во-вторых, учитывая естественную концентрацию энтерококков в кишечнике человека – 107–108 на грамм кишечного содержимого, нетрудно подсчитать, что для введения сколько-нибудь значимого количества пробиотиков, сравнимого с количеством собственных энтерококков, нужно в сотни раз увеличивать дозы приема. Так, предлагаемая дозировка пробиотика Линекс составляет 0,1–0,2% от естественного количества энтерококков.

В-третьих, исследования штаммов энтерококков, используемых в качестве пробиотиков, выявили их низкий уровень генетической компетентности по сравнению с индигенными штаммами, что также снижает риск приобретения новых генетических маркеров [49]. И что особенно важно, штаммы энтерококков, используемые в клинике, наиболее тщательно отбираются в плане их безопасности, начиная с экспериментов на лабораторных животных и заканчивая наблюдениями за больными. Исследования молочнокислого продукта, содержащего E. faecium SF68, в плане возможной передачи данному штамму устойчивости к ванкомицину, проведенное на добровольцах, не выявили ни одного случая приобретения данного признака штаммом пробиотика [54]. В настоящее время наиболее достоверным критерием, позволяющим охарактеризовать энтерококки в плане их потенциальной патогенности, является наличие у энтерококкового штамма набора генов патогенности (см. табл. 3). Большинство генов патогенности (например, комплекс генов цитолизинов) обнаруживается только у бактериальных клеток Enterococcus faecalis, причем последние располагаются на геноме в пределах «островов» патогенности [3]. У штаммов E. faecium частота обнаружения генов патогенности существенно ниже – наиболее часто удается обнаружить либо гены, кодирующие синтез факторов адгезии, либо гены устойчивости к антибиотикам [58]. Обнаружена закономерная связь между наличием в штаммах энтерококков тех или иных генов патогенности и характером течения патологического процесса [30]. При этом штаммы энтерококков – представители нормальной микрофлоры практически никогда не содержали генов цитолизинов при достаточно высоком содержании факторов адгезии [30]. Энтерококки же, выделенные из пищевых продуктов или штаммов пробиотиков, оказались практически свободными от генов факторов патогенности, за исключением наличия гена gelЕ [32]. В аналогичном исследовании коллекции патогенных штаммов энтерококков по сравнению с пробиотическим штаммом L3 было показано, что данный штамм также не содержит генов патогенности, выбранных для исследования [51]. В недавно проведенном исследовании клинических штаммов энтерококков (собственные данные авторов), выделенных от больных, принимавших пробиотик Линекс, было установлено, что ни один из этих штаммов не имел генетических характеристик, свойственных штамму E. faecium, входящему в состав препарата Линекс, а бактерии пробиотического штамма не содержали известных генов патогенности, детектируемых с помощью ПЦР (табл. 7).

Таблица 7. Анализ клинических штаммов энтерококков на предмет наличия генов патогенности

Образец123456789101112131415К
Праймеры
E. faecalis++++++
E. faecium+++++++++++/–*
gelE++/*–+/–*++++
еsp++++/–*+/–*
sprE+++
fsrB++
аsa1+++/–*++
cylA
cyIM
efaA+++
* Размер ампликона отличен от ожидаемого, штамм № 5 соответствует штамму E. faecium, входящему в состав препарата Линекс, штамм № 6 соответствует другому штамму SF68, использованному в качестве контроля.

Как уже отмечалось, энтерококки с давних времен применяются для производства и сохранения пищевых продуктов – за счет их способности ферментировать лактозу и угнетать развитие патогенных бактерий. В настоящее время российские исследователи пытаются выделить пробиотические и пищевые энтерококки в новый вид микроорганизмов – Enterococcus lactis [23].

Послесловие

Приведенные нами данные литературы указывают на неоднозначную роль энтерококков в жизни человека. Энтерококки широко распространены в природе. Они являются представителями резидентной нормальной микрофлоры человека и животных, встречаются в пищевых продуктах, воде, растениях, у животных, птиц и насекомых. У людей, как и у животных, они обитают в кишечнике, женском генитальном тракте, реже в уретре мужчин, могут колонизировать слизистые оболочки полости рта и кожу, особенно в условиях стационаров.

Некоторые штаммы данных микроорганизмов, приобретя ряд признаков патогенности, могут вызывать серьезные инфекционные заболевания, а другие штаммы служат необходимым компонентом нормального микробиоценоза. Ключевым критерием для отдифференцировки энтерококков, полезных для человека, от энтерококков патогенных является наличие или отсутствие у штамма энтерококков набора генов патогенности.

Важное значение имеет определение у клинических изолятов Е. faecalis и Е. faecium генов, контролирующих синтез известных факторов патогенности: Esp, Asa1 и EfaA – поверхностные белки, участвующие в процессе адгезии и инвазии; CylA и CylM – цитолизины; GelE – желатиназа; SprE – сериновая протеиназа и FsrB – феромон. Некоторые штаммы Е. faecalis обладают гиалуронидазной активностью. Энтерококковый цитолизин поражает эритроциты и некоторые эукариотические типы клеток, в то время как бактериальный феромон является низкомолекулярным пептидом, способствующим конъюгативной передаче плазмидной ДНК от штамма к штамму. Существует предположение, что этот феромон может действовать как хемоаттрактант для нейтрофилов, способствуя усилению воспалительного ответа на инфекцию. Более того, у клинических штаммов E. faеcalis обнаружена плазмида, кодирующая синтез поверхностного белка, сообщающего способность энтерококкам к интернализации клетками кишечного эпителия, культивируемыми in vitro [63].

Следует указать, что энтерококки редко являются причиной инфицирования у здоровых лиц. Только при значительном снижении резистентности макроорганизма, и особенно при травмах кишечника или мочеполового тракта в результате инструментальных исследований, они могут проникать в стерильные в нормальных условиях органы и ткани организма хозяина, вызывая оппортунистические инфекции мочевыводящих путей, бактериемию, сепсис, подострый септический эндокардит, инфекции желчных путей или абсцессы в брюшной полости.

Лабораторная диагностика. Для выделения энтерококков применяют стандартные методы получения проб крови, мочи, отделяемого ран и других видов клинического материала, используя при необходимости стерильные ватные тампоны. Для доставки материала в лабораторию возможно использование любой транспортной среды или сухого тампона. Посев проб должен быть осуществлен как можно скорее после их получения, предпочтительнее в течение одного часа. Лабораторную диагностику энтерококковых инфекций осуществляют с использованием бактериологического метода исследования, предусматривающего посев патологического материала на питательные среды с последующим выделением чистых культур, подозрительных на энтерококки. Используют энтерококк-агар производства ГНЦ ПМ (Оболенск) или производства ФГУП «Аллерген» (Ставрополь), Enterococcus Agar или HiCrome UTI Agar (М1353) фирмы HiMedia (Индия). Следует отметить, что на чашках с хромогенным агаром HiCrome UTI возможно дифференцировать одновременно колонии Enterococcus faecalis (голубовато-зеленого цвета), Escherichia coli (пурпурного цвета), Staphylococcus aureus (бесцветные колонии) и Klebsiella pneumoniae (мукоидные колонии голубого цвета). Для последующей видовой идентификации колонии, типичные для энтерококков, отвивают на азидовый агар. Выделенные штаммы дифференцируют с гемолитическими и зеленящими стрептококками. Идентификацию проводят с помощью физиолого-биохимических тестов.

Первый день: посев поступившего на исследование клинического материала производят принятыми при диагностике стрептококковых инфекций методами с использованием питательных сред.

Второй день:

  1. просматривают первичные посевы на чашках с кровяным агаром. Энтерококки образуют мелкие кремовые или белые, круглые, с ровными краями глянцевые колонии с α-, β-гемолизом или негемолитические;
  2. из колоний с признаками, характерными для энтерококков, бактериологической петлей берут небольшое количество материала и готовят мазки для окраски по Граму. При микроскопическом исследовании энтерококки представляют собой грамположительные полиморфные кокки, располагающиеся короткими цепочками или небольшими скоплениями, что определяет необходимость дифференцировать их с гемолитическими и зеленящими стрептококками;
  3. колонии, характерные для энтерококков, высевают и в бульон для получения чистой культуры, необходимой нейшей идентификации.

Идентификация видовой принадлежности энтерококков

Первый день: суточную бульонную культуру энтерококка

  1. на желчно-щелочной агар (ЖЩА);
  2. в молоко с 0,1% раствором метиленового синего.

Второй и третий дни:

  1. если на ЖЩА есть рост в виде круглых, блестящих, синеватого цвета, слегка выпуклых колоний, которые случаев появляются на третьи сутки инкубирования при 37°С, исследуемая культура подозрительна на
  2. в пробирках с молоком энтерококки редуцируют вследствие чего уже через 16–20 часов после посева в термостате цвет среды изменяется с голубого на Способность микробных культур к росту на ЖЩА 0,1% раствором метиленового синего в молоке указывает ность исследуемой культуры к энтерококкам. Идентификация принадлежности энтерококков и определение спектра к антибактериальным препаратам и действию лечебного могут быть необходимы для назначения больному адекватной иногда и в эпидемиологических целях. Известно, что проявляют более выраженную резистентность к пенициллину циллину, чем культуры Е. faecalis. Резистентность к наиболее часто определяется у Е. faecium. Идентификацию рококков осуществляют с помощью биохимических тестов. Более 80% энтерококков реагируют с антисывороткой по Лэнсфилду.

Молекулярно-генетическая идентификация ДНК

Используются праймеры к трем группам генов:

  1. для видовой идентификации – позволяющие дифференцировать штаммы E. faecium и Е. faecalis;
  2. гены поверхностных белков-адгезинов (esp, asa1, efaA);
  3. гены, кодирующие синтез цитолизинов (cylA, cylM), желатиназы (gelE), сериновой протеиназы (sprE) и феромона (fsrB).

Праймеры, рекомендуемые для выявления генов, ассоциированных с патогенностью изолятов Еnterococcus faecalis и Еnterococcus faecium, приведены в таблице 8.

Выбор данных праймеров обусловлен принятыми в современной научной литературе стандартными подходами, позволяющими отличить патогенные штаммы энтерококков от апатогенных.

Таблица 8. Праймеры, используемые для выявления генов, ассоциированных с патогенностью энтерококков

Название генаПоследовательность ДНК праймеров
(5’ to 3)
Размер
ампликона (нп)
gelEgelE 1ACCCCGTATCATTGGTTT419
gelE 2ACGCATTGCTTTTCCATC
espesp 1TTGCTAATGCTAGTCCACGACC93
esp 2GCGTCAACACTTGCATTGCCGAA
sprEsprE 1GCGTCAATCGGAAGAATCAT233
sprE 2CGGGGAAAAAGCTACATCAA
fsrВfsrB 1TTTATTGGTATGCGCCACAA316
fsrB 2TCATCAGACCTTGGATGACG
asa1asa1 1CCAGCCAACTATGGCGGAATC529
asa1 2CCTGTCGCAAGATCGACTGTA
cylA Ft56ACTCGGGGATTGATAGGC688
RGCTGCTAAAGCTGCGCTT
E. faecalisF t54TCAAGTACAGTTAGTCTTTATTAG941
RACGATTCAAAGCTAACTGAATCAGT
E. faeciumF t54TTGAGGCAGACCAGATTGACG658
RTATGACAGCGACTCCGATTCC
cylMFGATTGGAATGTGGGAATCCTAA825
RACTTCCGGCAACCTTTAGTGTA
efaAFCGTTAGCTGCTTGCGGGAATC735
RCCATACTACGTTTATCGACAC

Лечение и профилактика. Многочисленные исследования свидетельствуют о свойственной энтерококкам резистентности к широкому спектру антибактериальных препаратов. Чувствительность к действию антибиотиков двух наиболее часто выделяемых при инфекциях человека видов — Е. faecalis и Е. faecium — различна. Известно, что около 90% штаммов Е. faecalis и около 50% штаммов Е. faecium чувствительны к ампициллину. При резистентности энтерококков к ампициллину необходимо использовать ванкомицин. Неосложненные инфекции мочевыводящих путей лечат ампициллином, тетрациклином или хинолонами. При системных инфекциях энтерококковой природы, опасных для жизни, целесообразно использовать антибиотики, действующие на клеточную стенку, такие как пенициллин, ампициллин или ванкомицин, в сочетании с аминогликозидами (гентамицином или стрептомицином) или хлорамфениколом. Однако выбор наиболее эффективной комбинации антибиотиков для лечения системных энтерококковых инфекций возможен только после предварительного определения in vitro антибиотикорезистентности выделяемых в каждом конкретном случае культур энтерококков. Интенсивная терапия антибиотиками, не эффективными в отношении энтерококков, может способствовать возникновению генерализованных энтерококковых инфекций, уничтожая нормальную микрофлору, конкурирующую с энтерококками, с одной стороны, и оказывая иммуносупрессивное действие — с другой. Учитывая рост в последние годы внутригоспитальных инфекций, вызываемых полирезистентными энтерококками, появляющимися в результате селекции в связи с широким использованием антибиотиков в стационарах, важнейшим фактором предупреждения нозокомиальных энтерококковых инфекций следует признать четко обоснованное применение антибиотиков.

Пробиотические препараты. Энтерококки и кишечные палочки явились основой первых препаратов-пробиотиков, производство которых было налажено в Европе в середине 20-х годов прошлого столетия. Следует отметить, что при заселении кишечника колиподобной микрофлорой и энтерококком наблюдается образование колоний только на поверхности слизистой оболочки, выявляемых гистологически (Savage et al., 1968). В настоящее время существует довольно большая группа пробиотических препаратов, включающих симбиотические штаммы энтерококков и оказывающих благотворное воздействие на человеческий организм.

Особенно ценными свойствами этерококков являются:

  • высокая антагонистическая активность в отношении патогенной микрофлоры,
  • участие в формировании и поддержании иммунитета,
  • участие в нормальном пищеварении,
  • противовоспалительные свойства,
  • витаминообразование,
  • восстановление нормального микробиоценоза кишечника [4, 7, 29, 37, 76].

Ярким представителем энтерококксодержащих средств, представленных на российском рынке, является препарат Линекс, высокая пробиотическая эффективность которого подтверждена длительным опытом клинического применения как в нашей стране, так и за рубежом.

Литература

  1. Билимова С.И. Характеристика факторов персистенции энтерококков. Журн. микробиол. 2000, 4: 104, 105.
  2. Бондаренко В.М. Поликомпонентные пробиотики: механизм действия и терапевтический эффект при дисбиозах кишечника. Фарматека. 2005, 20 (115): 46–54.
  3. Бондаренко В.М. «Острова» патогенности бактерий. Журн. микробиол. 2001, 4: 67–74.
  4. Бондаренко В.М., Мацулевич Т.В. Дисбактериоз кишечника как клинико-лабораторный синдром: современное состояние проблемы. ГЭОТАР-Медиа. М., 2007, 304 с.
  5. Бондаренко В.М., Петровская В.Г. Ранние этапы развития инфекционного процесса и двойственная роль нормальной микрофлоры. Вестн. РАМН. 1997 , 3: 7–10.
  6. Габриэлян И.Н., Горская Е.М., Спирина Т.С., Преображенская Т.Б. Энтерококки как возбудители инфекционных послеоперационных осложнений. Журн. микробиол. 2007, 4: 50–53.
  7. Грачева Н.М., Бондаренко В.М. Пробиотические препараты в терапии и профилактике дисбактериоза кишечника. Инфекц. болезни. 2004, 2 (2): 53 –58.
  8. Зубов Л.А., Богданов Ю.М. Современные проблемы антибиотикорезистентности в педиатрической клинике. Антибиотики и химиотерапия. 1998 , 38 (6): 43 –49.
  9. Сидоренко С.В. Клиническое значение антибиотикорезистентности грамположительных микроорганизмов. Инфекции и антимикробная терапия. 2003, 5 (2): 3–15.
  10. Отраслевой стандарт «Протокол ведения больных. Дисбактериоз кишечника» (ОСТ 91500.11.0004–2003, утвержден Приказом Министерства здравоохранения РФ № 231 от 09.06.2003 г.).
  11. Смирнова И.И., Филатова Е., Суворов А.Н., Былинская Е.Н. Опыт применения лечебно-профилактического драже «Ламинолакт медовый» при лучевом лечении больных раком тела матки. Вопросы онкологии. 2000, 6 (46): 748 –75 0.
  12. Тимофеева Е.И., Радченко В.Г., Суворов А.Н. Использование биопродукта «Ламинолакт» в комплексной терапии хронических гепатитов. Terra Medika Nova. 199 , 2: 19–35.
  13. Agerbaek М., Gerdes L.U., Richelsen B. Hypocholesteroleamic effect of a new fermented milk product in healthy middle-aged men. Eur. J. Clin. Nutr. 1995 , 49: 34 6–35 2.
  14. Allen W.D., Linggood M.A., Porter P. Enterococcus organisms and their use as probiotics in alleviating irritable bowel syndrome symptoms. European Patent 05087 01 (B1), 199 6.
  15. Aymerich T., Garriga M., Ylla J., Vallier J., Monfort J.M., Hugas M. Application of enterocins as biopreservatives against Listeria innocua in meat products. Journal of Food Protection 2000, 63: 721–726.
  16. Aymerich M.T., Garriga M., Costa S. et al. Prevention of ropiness in cooked pork by bacteriocinogenic cultures. Int. Dairy J. 2002, 12: 239 –246.
  17. Balla E., Dicks L.M., du Toit M. et al. Characterization and cloning of the genes encoding enterocin 1071A and enterocin 1071B, two antimicrobial peptides produced by Enterococcus faecalis BFE1071. Appl. Envir. Microbiol. 2000, 66: 1298 –1304.
  18. Begley M., Gahan C.G., Hill C. The interaction between bacteria and bile. FEMS Microbiol. Rev. 2005, 29: 625–651.
  19. Bellomo G., Mangiagle A., Nicastro L., Frigerio G. A controlled double-blind study of SF68 strain as a new biological preparation for the treatment of diarrhoea in pediatrics. Curr. Ther. Res. 198 0, 28: 927–93 6.
  20. Bensing B.A., Dunny G.M. Cloning and molecular analysis of genes affecting expression of binding substance, the recipient-encoded receptor(s) mediating mating aggregate formation in Enterococcus faecalis. J Bacteriol. 1993 , 175: 74 21–74 29.
  21. Benyacoub J., Czarnecki-Maulden G.L., Cavadini C. et al. Supplementation of food with Enterococcus faecium (SF68) stimulates immune functions in young dogs. J. Nutr. 2003, 133 : 1158 –1162.
  22. Boyce J.M., Mermel L., Zevos M.J. et al. Controlling vancomycin-resistant enterococci. Infect. Control. Hosp. Epidmiol. 1995 , 16: 634 –637.
  23. Botina S.G., Sukhodolets V.V. Speciation in bacteria: comparison of the 16S rRNA gene for closely related Enterococcus species. Russian J. Genetics. 2005, 42: 325–33 2.
  24. Buydens P., Debeuckelaere S. Efficacy of SF 68 in the treatment of acute diarrhea. A placebo-controlled trial. Scand. J. Gastroenterol. 199 6, 31: 887 –89 1. 25. Callewaert M.H., De Vuyst L. Competitiveness and bacteriocin production of enterococci in the production of Spanish-style dry fermented sausages. Int. J. Food Microbiol. 2000, 57 : 33 –42.
  25. Chenoweth C., Schaberg C. The epidemiology of enterococci. Eur. J. Clin. Microbiol. 199 0, 9: 80–89.
  26. Coburn P.S., Gilmore M.S. The Enterococcus faecalis cytolysin: a novel toxin active against eukaryotic and prokaryotic cells. Cell Microbiol. 2003, 5 (10): 661–669.
  27. Coque T.M., Patterson J.E., Steckelberg J.M. et al. Incidence of hemolysin, gelatinase-andeagregation substance among enterococci isolated from patients with endocarditis and other infections and from feces of hospitalized and community-based persons. J. Infect. Dis. 1995 , 171 (5): 1223–1229.
  28. Collins M.D., Gibson G.R. Probiotics, prebiotics, and synbiotics: approaches for modulating the microbial ecology of the gut. Am. J. Clin. Nutr. 199 , 69: 1052–1057.
  29. Creti R., Imperi M., Bertuccini L. et al. Survey for virulence among Enterococcus faecalis isolated from different sources. J. Med. Microbiol. 2004, 53 : 13–20.
  30. Dunny G.M., Craig R.A., Carron R.L., Clewell D.B. Plasmid transfer in Streptococcus faecalis: production of multiple sex pheromones by recipients. Plasmid. 1979 , 2: 454 –465.
  31. Eaton T.J., Gasson M.J. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Environ. Microbiol. 2001, 67: 1628–1635.
  32. Edmond M.B. Multidrug-resistant enterococci and the threat of vancomycinresistant Staphylococcus aureus. In: Wenzel R.P. (ed.), Prevention and Control of Nosocomial Infections. 1997. P. 339 –335.
  33. Evers S., Sahm D.F., Courvalin P. The vanB gene of vancomycin-resistant Enterococcus faecalis V583 is structurally related to genes encoding D-Ala ligases and glycopeptide-resistance proteins VanA and VanC. Gene. 1993 , 124: 143 , 144.
  34. Farias M.T., de Ruiz Holgado A., Sesma F. Bacteriocin production by lactic acid bacteria isolated from regional cheeses: inhibition of foodborne pathogens. J. Food Protection. 1994 , 57 : 1013–1015.
  35. Foulquie Moreno M.R., Rea M., Cogan T., De Vuyst L. Applicability of a bacteriocin-producing Enterococcus faecium as a co-culture in Cheddar cheese manufacture. Int. J. Food Microbiol. 2003, 81: 73 –84.
  36. Fuller R. Probiotics in man and animals. J. Appl. Bacteriol. 1989 , 66: 365–378.
  37. Giard J.C., Verneuil N., Auffray Y., Hartke A. Characterization of genes homologous to the general stress-inducible gene gls24 in Enterococcus faecalis and Lactococcus lactis. FEMS Microbiol. Lett. 2002, 206: 235 –239.
  38. Gilmore M.S., Segarra R.A., Booth M.C., Bogie C.P., Hall L.R. et al. Genetic structure of the Enterococcus faecalis plasmid pAD1-encoded cytolytic toxin system and its relationship to lantibiotic determinants. J. Bacteriol. 1994 , 176: 735 –734.
  39. Giraffa G. Enterococci from foods. FEMS Microbiol. Rev. 2002, 26: 163–171.
  40. Hancock L.E., Gilmore M.S. The capsular polysaccharide of Enterococcus faecalis and its relationship to other polysaccharides in the cell wall. Proc. Natl. Acad. Sci. USA. 2002, 99 : 1574 –1579.
  41. Havenaar R., Huis in›t, Veld J.H. Probiotics, general view. In: Wood J.B.J. еd., Lactic Acid Bacteria in Health and Disease. Elsevier, London. 199 2. P. 151–170.
  42. Hlivak P., Janova E., Odrazka J. et al. Long-term (56 week) oral administration of probiotic E. faecium M-74 decreses the expression of sICAM-1 and monocyte CD49 in humans. Bratisl. Lek. Listy. 2005, 106 (4–5): 175 –181.
  43. Huycke M.M., Sahm D.F., Gilmore M.S. Multiple-drug resistant еnterococci: the nature of the problem and an agenda for the future. Emerg. Infect. Dis. 1998, 4: 239–249.
  44. Ike Y., Clewell D.B. Evidence that the hemolysin/bacteriocin phenotype of Enterococcus faecalis subsp. zymogenes can be determined by plasmids in different incompatibility groups as well as by the chromosome. J. Bacteriol. 199 2, 174 : 8172–8177.
  45. Isolauri E., Kirjavainen P.V., Salminen S. Probiotics: a role in the treatment of intestinal infection and inflammation? Gut. 2002, 50 (Suppl. 3): 54 –59.
  46. Kayaoglu G., Orstavik D. Virulence factors of Enterococcus faecalis: relationship to endodontic disease. Crit. Rev. Oral Biol. Med. 2004, 15: 308–320.
  47. Klaenhammer T.R. Genetics of bacteriocins produced by lactic acid bacteria. FEMS Microbiol. Rev. 1993 , 12: 39 –85.
  48. Klein G. Taxonomy, ecology and antibiotic resistance of enterococci from food and the gastro-intestinal tract. Int. J. Food Microbiol. 2003, 88 : 123–131.
  49. Koneman E.W. et al. Color atlas and textbook of diagnostic microbiology. 1997.
  50. Kolodjieva V., Yafaev R., Yermolenko E., Suvorov A. Incidence of virulence determinants in enterococcal strains of probiotic and clinical origin. New Insights Into and Old Enemy. 2006, 367–37 0.
  51. Laukova A., Czikkova S. Antagonistic effect of enterocin CCM 4231 from Enterococcus faecium on «bryndza», a traditional Slovak dairy product from sheep milk. Microbiol. Res. 2001, 156: 31–34.
  52. Laukova A., Vlaemynick G., Czikkova S. Effect of enterocin CCM 4231 on Listeria monocytogenes in Saint-Paulin cheese. Folia Microbiol. 2001, 46: 157 –160.
  53. Lund B., Edlund C., Barkholt L. et al. Impact on human intestinal microflora of an Enterococcus faecium probiotic and vancomycin. Scand. J. Infect. Dis. 2000, 32: 627–632.
  54. Maekawa S., Yoshioka M., Kumamoto Y. Proposal of a new scheme for the serological typing of Enterococcus faecalis strains. Microbiol. Immunol. 199 2, 36: 671–681.
  55. Manson J.M, Keis S., Smith J.M., Cook G.M. A clonal lineage of VanA-type Enterococcus faecalis predominates in vancomycin-resistant еnterococci isolated in New Zealand. Antimicrob. Agents Chemother. 2003, 47 : 204–210.
  56. Mathur S., Singh R. Antibiotic resistance in food lactic acid bacteria – a review. Int. J. Food Microbiol. 2005, 105: 281–295.
  57. McBride S., Fischetti V., LeBlanc D. et al. Genetic diversity among Enterococcus faecalis. PLoS ONE. 2007, 2: 58 2–58 6.
  58. Murray B.E. The life and times of the Enterococcus. Clin. Microbiol. 199 0, 3: 46–65.
  59. Nallapareddy S.R., Duh R.W., Singh K.V., Murray B.E. Molecular typing of selected Enterococcus faecalis isolates: pilot study using multilocus sequence typing and pulsed-field gel electrophoresis. J. Clin. Microbiol. 2002, 40: 868–87 6.
  60. Nallapareddy S.R., Qin X., Weinstock G.M. et al. Enterococcus faecalis adhesin, ace, mediates attachment to extracellular matrix proteins collagen type IV and laminin as well as collagen type I. Infect. Immun. 2000, 68: 5218–5224.
  61. Noskin G.A., Stozor V., Cooper I., Peterson L.R. Recovery of vancomycinresistant enterococci on fingerprints and environmental surfaces. Infect. Control. Hosp. Epidemiol. 1995 , 16: 57 –58 1.
  62. Olmsted S.B., Dunny G.M., Erlansen S.L., Wells C.L. A plasmid encoded surface protein on Enterococcus faecalis augments its internalization by cultured intestinal epithelial cells. J. Infect. Dis. 1994 , 170: 1549 –155 6.
  63. Patterson J.E., Sweeney A.H., Simms M. et al. An analysis of 110 serious enterococcal infections: epidemiology, antibiotic susceptibility, and outcome. Medicine. 1995 , 56: 191–200.
  64. Qin X., Singh K.V., Weinstock G.M., Murray B.E. Effects of Enterococcus faecalis fsr genes on production of gelatinase and a serine protease and virulence. Infect. Immun. 2000, 68: 2579 –258 6.
  65. Rodriguez J.M., Martinez M.I., Horn N., Dodd H.M. Heterologous production of bacteriocins by lactic acid bacteria. Int. J. Food Microbiol. 2003, 80: 101–116.
  66. Sabia C., de Niederhausern S., Messi P. et al. Bacteriocin-producing Enterococcus casseliflavus IM 416K1, a natural antagonist for control of Listeria monocytogenes in Italian sausages («cacciatore»). Int. J. Food Microbiol. 2003, 87 : 173 –179.
  67. Salminen S., Isolauri E., Salminen E. Clinical uses of probiotics for stabilising gut mucosal barrier: successful strains and future challenges. Antonie van Leeuwenhoek. 199 6, 70: 347 –358.
  68. Sarantinopoulos P., Kalantzopoulos G., Tsakalidou E. Citrate metabolism by Enterococcus faecalis FAIR-E 229. Appl. Envir. Microbiol. 2001, 67: 548 2–5487.
  69. Shankar N., Baghdayan A.S., Gilmore M.S. Modulation of virulence within a pathogenicity island in vancomycin-resistant Enterococcus faecalis. Nature. 2002, 417: 74 6–75 0.
  70. Sharpe M.E. Serological types of Streptococcus faecalis and its varieties and their cell wall type antigen. J. Gen. Microbiol. 1964, 36: 151–160.
  71. Simanenkov V., Suvorov A., Bovaeva D., Solovieva O. Effect of the therapy of patients with H.pylori related gastritis is correlated with organization of cag pathogenicity island. European congress of clinical microbiology and infection diseases. 2004, Prague. P. 179.
  72. Spera R.V., Farber B.F. Multiply-resistant Enterococcus faecium: the nosocomial pathogen of the 199 0. JAMA. 199 2, 268: 2563–2564.
  73. Wiedemann I., Bottiger T., Bonelli R. et al. The mode of action of the lantibiotic lacticin 3147 – a complex mechanism involving specific interaction of two peptides and the cell wall precursor lipid II. Mol. microbiol. 2006, 61 (2): 285 –296.
  74. Wunderlich P.F., Braun L., Fumagalli I. et al. Double-blind report on the efficacy of lactic acid-producing Enterococcus SF68 in the prevention of antibioticassociated diarrhoea and in the treatment of acute diarrhea. J. Int. Med. Res. 1989 , 17: 33 –338.
  75. Yermolenko E., Chernish A., Aleshina G. et al. Antagonistic activity of Enterococcus faecium L3 against different groups of pathogenic streptococci. New Insights Into and Old Enemy. 2006. P. 363–366.

1 октября 2008 г.
Комментарии (видны только специалистам, верифицированным редакцией МЕДИ РУ)
Если Вы медицинский специалист, войдите или зарегистрируйтесь

МЕДИ РУ в: МЕДИ РУ на YouTube МЕДИ РУ в Twitter МЕДИ РУ на FaceBook МЕДИ РУ вКонтакте Яндекс.Метрика